Primary Identifier | MGI:6382547 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Kin |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTATCATTAACCCATTTGCA and TCAAAGCTCTCCCCACCTAG, which resulted in a 418 bp deletion beginning at Chromosome 2 position 10,085,644 bp and ending after 10,086,061 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001220233 (exon 2) and 323 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 38 and early truncation 4 amino acids later. |