Primary Identifier | MGI:6314562 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Rcan3 |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTCGAGTGTGAACTCAGAC and TTAACGGGAGACCTGCTAAG, which resulted in a 2462 bp deletion beginning at Chromosome 4 position 135,418,238 bp and ending after 135,420,699 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000182355 and ENSMUSE00000264256 (exons 3 and 4) and 2106 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 65 and early truncation 50 amino acids later. |