Primary Identifier | MGI:6294074 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Raver2 |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GATTCCCGTGTGACCTCAGG and AACACTTAGGAACCCCACCG, which resulted in a 493 bp deletion beginning at Chromosome 4 position 101,095,998 bp and ending after 101,096,490 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001244538 (exon 2) and 426 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 72 and early truncation 5 amino acids later. |