|  Help  |  About  |  Contact Us

Allele : Tomm20l<em1Kzt> translocase of outer mitochondrial membrane 20-like; endonuclease-mediated mutation 1, Keizo Tokuhiro

Primary Identifier  MGI:6830927 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Tomm20l
Strain of Origin  (C57BL/6NJcl x DBA/2NJcl)F2 Is Recombinase  false
Is Wild Type  false
molecularNote  CRISPR/Cas9 technology generated a 483 bp deletion using gRNAs TGCAGTGTCCTTGGGTCGCC and GAGGTGCAGCAGACCCGCCA.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele