Primary Identifier | MGI:6147537 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Rhobtb1 |
Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
Is Wild Type | false | Project Collection | IMPC |
molecularNote | This allele from IMPC was generated at Czech centre for Phenogenomics by injecting CAS9 RNA and the guide sequence TCGTGGGCGACAACGCCGTAGGG, which resulted in a Indel. |