Primary Identifier | MGI:7484552 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Ccser2 |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTGTATTGAGAAGTGCCCCT and CAAATGCTGTTATAATAGAT, which resulted in a 465 bp deletion beginning at Chromosome 14 position 36,938,415 bp and ending after 36,938,879 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001237712 (exon 3) and 268 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 471 and early truncation 4 amino acids later. |