| Primary Identifier | MGI:5697086 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Kcnc3 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Kcnc3-7063J-F4895 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences, GCTTCTAAAGAACTTGGTGG, CTACTATGCCGAACGCATCG, and AGAGGTGATTGAAACCAACA, which resulted in a 1182 bp deletion in exon 2 beginning at Chromosome 7 positive strand position 44,595,080 bp, GTGAGGCCACCACCAAGTTCTTTAG, and ending after CAAGAAGAGGTGATTGAAACCAACA at 44,596,261 bp (GRCm38/mm10). This mutation deletes most of exon 2, except for the last 7 bp, and deletes the splice acceptor. It is predicted to result in a change in amino acid sequence after 291 amino acid residues and early truncation 71 amino acids later. |
