| Primary Identifier | MGI:7491739 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Fer1l6 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATTTCACCAGAGATGTAGAG and AGGAGAAGAGCGTAGCCACT, which resulted in a 635 bp deletion beginning at Chromosome 15 position 58,549,969 bp and ending after 58,550,603 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000851953 and ENSMUSE00000870098 (exons 4-5) and 448 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 64 and early truncation 27 amino acids later. There is a single bp insertion (T) at the deletion site. |
