Primary Identifier | MGI:5912036 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Gpr135 |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele from project Gpr135-8910J-7449M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AACTGCATAATTCTGAAACC, CCGACTTCCATAACTGAGTC, CGGATGCGCGCTACCCTGCA and CTTGCAGGGTAGCGCGCATC, which resulted in a 1370 bp deletion beginning at Chromosome 12 negative strand position 72,071,005 bp and ending after 72,069,636 bp (GRCm38/mm10). This mutation creates an internal deletion of 1370 bp from ENSMUSE00000353393 (exon 1) including 14 bp of 5 UTR and 1356 bp of coding sequence, leaving 15 bp of coding sequence and a TAA stop. This deletion is predicted to result in a loss of almost all amino acid coding sequence for Grp135 and generate a null allele. |