|  Help  |  About  |  Contact Us

Allele : Il2ra<em1Mson> interleukin 2 receptor, alpha chain; endonuclease-mediated mutation 1, Alexander Marson
Primary Identifier  MGI:6110563 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Il2ra
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  CRISPR/Cas9 technology inserted an Il2ra intron 1 enhancer region guide RNA and Cas9 mRNA. The gRNA carries a C to T mutation associated with human inflammatory bowel disease (GAAGGAGGTATCTATTTTGGTCCC to GAAGGAGGTATTTATTTTGGTCCC) and Type 1 Diabetes (T1D). Expression of the Il2ra gene is not blocked, but in vitro gene activation in response to cell stimulation with anti-CD3/CD28 antibodies is delayed.
  • mutations:
  • Insertion,
  • Single point mutation
  • synonyms:
  • SNP,
  • SNP
Paste the following link
Quick Links:
SummaryGenomePhenotypeOther
 
Quick Links:
SummaryGenomePhenotypeOther
 
Lists
This Allele isn't in any lists. Upload a list.

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

2 Publication categories

Trail: Allele




MouseMine is a collaboration between MGI at The Jackson Laboratory and the InterMine project at the Cambridge Systems Biology Centre. MouseMine is funded through a grant from the NIH/NHGRI.The Jackson Laboratory makes no representation about the suitability or accuracy of this software or data for any purpose, and makes no warranties, either express or implied, including merchantability and fitness for a particular purpose or that the use of this software or data will not infringe any third party patents, copyrights, trademarks, or other rights. the software and data are provided "as is". This software and data are provided to enhance knowledge and encourage progress in the scientific community and are to be used only for research and educational purposes. Any reproduction or use for commercial purpose is prohibited without the prior express written permission of the Jackson Laboratory.

Copyright © 2017 by The Jackson Laboratory. All Rights Reserved

© 2002 - 2017 Department of Genetics, University of Cambridge, Downing Street,
Cambridge CB2 3EH, United Kingdom