| Primary Identifier | MGI:5629302 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ubn1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Ubn1-6239J-105P8MR was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence ACGTAGGAAAGACCGAATAC which resulted in a 7 bp deletion ACCGAAT in exon 5 beginning at Chromosome 16 positive strand position 5,062,557 - 5,062,563 bp (GRCm38) that is predicted to cause amino acid sequence changes after residue 121 and early truncation 1 amino acid later. |
