| Primary Identifier | MGI:7489588 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr54 |
| Strain of Origin | FVB | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | The topologically associating domain (TAD) boundary region or insulator between Ctif and Zbtb7c, separating the Smad7 TAD from the Smad2 TAD, was targeted with sgRNAs (targeting TAAGATCTGTGCTACGGGGGGGG, CATCTGGCTAGCTCAATACACGG, CAATGGGATCTCCTTGGTCCTGG and CAAGCAGGGCAAGGGAGATTGGG) using CRISPR/Cas9 technology, resulting in a 72070 bp deletion (chr18:75847706-75919775 (GRCm39)). |
