| Primary Identifier | MGI:7328448 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Prr32 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TAGTGAAGTCATCAGTTGCT and CTACATGCCTAAAGCTAGGA, which resulted in a 2206 bp deletion beginning at Chromosome X position 45,090,823 bp and ending after 45,093,028 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000470701 and ENSMUSE00000323019 (exons 1 and 2) and 1096 bp of intronic sequence including the start site, splice acceptor and donor and is predicted to result in a null allele. |
