|  Help  |  About  |  Contact Us

Allele : Maz<em1(IMPC)Ics> MYC-associated zinc finger protein (purine-binding transcription factor); endonuclease-mediated mutation 1, Mouse Clinical Institute

Primary Identifier  MGI:6336151 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Maz
Strain of Origin  C57BL/6N Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from IMPC was generated at Institut Clinique de la Souris by injecting CAS9 RNA and 4 guide sequences CCTCTTCTAAAGTACCACCCCCT, CCGCCAGCGGCCGTTATTTCGCG, CCCCCACTTGAACGATTCCACCC, CCTGTCCCCAGGAACGGGAGCCG, which resulted in a Exon Deletion.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele