| Primary Identifier | MGI:5883421 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ccng2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Ccng2-8345J-F4819 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGCATCTAAGAGAAGCAACA, CTGAAATGTAAAATGATTGT, GTCTGTCCAGACTTTCGACT and GCAGCCACGCTGAAGGCCTG, which resulted in a 407 bp deletion beginning at Chromosome 5 positive strand position 93,270,724 bp ATGGCATTATTTCAAGCGTC, and ending after AGTCTGTCCAGACTTTCGAC at 93,271,130 bp (GRCm38/mm10). This mutation deletes exon 4 and 156 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 92 and early truncation 7 amino acids later. |
