| Primary Identifier | MGI:5812886 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Tctn3 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Tctn3-8161J-M2441 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCTGAGCAGTAGTTTAAAGG, CTTATTAACTAAAAGTAAGA, GCATTCCCAGGAAAGCCCAA and CCTACCCGCTGTCTCCCGGT, which resulted in a 448 bp deletion beginning at Chromosome 19 negative strand position 40,611,575 bp TGGGCTTTCCTGGGAATGCT, and ending after AACATTAGTAATTTCATGAG at 40,611,128 bp (GRCm38/mm10). This mutation deletes exon 3 and 329 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 14 bp deletion 10 bases before the 448 bp deletion and a 13 bp deletion 3 bases after the 448 bp deletion that will not alter the result of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 114 and early truncation 43 amino acids later. |
