Primary Identifier | MGI:6241417 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Mon1b |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGTAACTTAGACACAGCACG and TTAGACTTGAGGGTATCTCG, which resulted in a 1279 bp deletion beginning at Chromosome 8 position 113,638,301 bp and ending after 113,639,579 bp bp (GRCm38/mm10). This mutation deletes ENSMUSE00000305362 (exon 3) and 454 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 164 and early truncation 3 amino acids later. |