| Primary Identifier | MGI:5784541 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Tusc1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Tusc1-7713J-M6853 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCCATGATCCGGACGTTCCG, GTTGGTGGCGGGCTCGTCCG, AGCGGGACCGGCAGAACGCG and GGAGCGCTTCGCCGACCTGG, which resulted in a 413 bp deletion in exon 1 beginning at Chromosome 4 negative strand position 93,335,287 bp, GCCGCGCGGGCGGGGCCCGG, and ending after GCCCGCCGGGAGCCATCGAG at 93,334,875 bp (GRCm38/mm10). This mutation deletes 413 bp in exon 1 as well as an additional 3 bp (gtt) in the exon 50 bp after the 413 bp deletion, and is predicted to cause a change of amino acid sequence after residue 45 and early truncation 13 amino acids later. |
