|  Help  |  About  |  Contact Us

Allele : Scn9a<em1Wlf> sodium channel, voltage-gated, type IX, alpha; endonuclease-mediated mutation 1, Clifford J Woolf

Primary Identifier  MGI:7466218 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Scn9a
Inheritance Mode  Recessive Transmission  Germline
Strain of Origin  C57BL/6NTac Is Recombinase  false
Is Wild Type  false
molecularNote  Isoleucine codon 228 (ATT) in exon 6 was changed to methionine (ATG) using two sgRNAs (targeting ATTCCAGGTAAGAAGTGATTGG and CACACCAATCACTTCTTACCTGG) and an ssODN template (CAGCTCTTCGAACTTTCAGAGTCTTGAGAGCTTTGAAAACTATTTCCGTTATGCCGGGAAAGAAGTGATTGGTGTGGAGCTTTAGACTGCTCAACTCCAGCTG) using CRISPR/Cas9 technology. The equivalent human mutation is associated with small fiber neuropathy (SFN).
  • mutations:
  • Single point mutation
  • synonyms:
  • Nav1.7<I228M>,
  • Nav1.7<I228M>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

5 Publication categories

Trail: Allele