|  Help  |  About  |  Contact Us

Allele : Usp28<em1Baz> ubiquitin specific peptidase 28; endonuclease-mediated mutation 1, Hisham Bazzi

Primary Identifier  MGI:6510239 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Usp28
Strain of Origin  Not Specified Is Recombinase  false
Is Wild Type  false
molecularNote  CRISPR/Cas9 technology generated a 1 bp insertion in exon 2 (AATCAGCTGCGAGAAATCAC to AATCAGCTGCGAGAAATTCAC) using the gRNA AATCAGCTGCGAGAAATCAC.
  • mutations:
  • Insertion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele