Primary Identifier | MGI:6342531 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Tacc1 |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CGAGTACCCAGACATCCACG and ACGCTTGCATGGGAGAGCCG, which resulted in a 255 bp deletion beginning at Chromosome 8 position 25,177,885 bp and ending after 25,178,139 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000637671 (exon 2) and 194 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 55 and early truncation 4 amino acids later. There is a 3 bp insertion (TTA) at the deletion site. |