Primary Identifier | MGI:6490635 | Allele Type | Endonuclease-mediated |
Gene | Pole3 | Strain of Origin | FVB |
Is Recombinase | false | Is Wild Type | false |
molecularNote | A deletion-insertion (delGinsTA) in the 3' end of the coding region was created using sgRNAs (targeting CGGGAGCAGAAAGGCAAG) and an ssODN template (CGGTTTGTCTAATTAAACCATAATATCCTGCTTCCTTACAGCGTACAGGCAGGAACAGAAGGGCAAGAAGGAGGCTTCGGAGCAAAAGAAGAAGGACAAAGACAAAAAGGA) with CRISPR/Cas9 technology. The resulting frameshift creates a moderate net positive charge on the normally negatively charged tail of the encoded peptide. |