| Primary Identifier | MGI:5763071 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Mcmbp |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Mcmbp-7557J-M9618 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTGCGCTACTTCTAGTCACG, TTCTGTGTTGTGCCTCTAGA, GGACACTCACAGGTATTCAA and TCACCAGGCACCGCAAACCC, which resulted in a 361 bp deletion spanning exon 2 beginning at Chromosome 7 negative strand position 128,725,395 bp, AGGGAGCTAAGGGCAAGCAG, and ending after CCGCCCCACCAGCCACGTGAC at 128,725,035 bp (GRCm38/mm10). This mutation deletes exon 2 and 275 bp of flanking intronic sequence including the splice acceptor and donor. There is also a small 10 bp deletion (gcctctagat) 82 bp after the 361 bp deletion that will not affect the results of the mutation. This mutation is predicted to result in a change in amino acid sequence after residue 19 and an early truncation after an additional 28 amino acids. |
