Primary Identifier | MGI:6363556 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Smarce1 |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGGAAAAAATACTCCTTACA and TTTGAAACTGATTAAGCTAA, which resulted in a 955 bp deletion beginning at Chromosome 11 position 99,219,039 bp and ending after 99,219,993 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001261138, ENSMUSE00001305116 (exons 6 and 7) and 651 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 79 and early truncation 7 amino acids later. |