| Primary Identifier | MGI:6316199 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Mvk |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele produced from project TCPR0322 at TCP by injecting Cas9 mRNA and two guide RNAs with the spacer sequences ATAGGTGACTTAGCCTGACG and AGCCTCACCAACACGGGCAA resulting in a deletion of 666-bp from Chr5 from 114452050 to 114452715 witgh an insertion of a single T at the junction (GRCm38). |
