| Primary Identifier | MGI:6323011 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Polr3b |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | This allele from project TCPR0233 was generated at The Centre for Phenogenomics by injecting Cas9 ribonucleoprotein complexes with a single guide RNA with the spacer sequence TCATGTCCCTCAGACGGCAC resulting in two SNV changes C>T at Chr10:84632451 to disrupt PAM (within intron) and G>A at Chr10:84632459 which is predicted to result in a p.R103H change (GRCm38). |
