Primary Identifier | MGI:6258596 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Cmtr1 |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCAGGACCCACACTAGACAT and GGTGGGGCACAAGTTAGCAC, which resulted in a 344 bp deletion beginning at Chromosome 17 position 29,674,049 bp and ending after 29,674,392 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001374637 (exon 3) and 192 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 43 and early truncation 12 amino acids later. |