Primary Identifier | MGI:5810347 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Efhc2 |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele from project Efhc2-8032J-F7960 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGGAGGATCCCAAAAAGTAC, GGGAGGATCCCAAAAAGTAC, ATAAATTCCTGCTAGCCAAA and ATTTGGCTAGCAGGAATTTA, which resulted in a 379 bp deletion beginning at Chromosome X negative strand position 17,230,771 bp TTCCTGCTAGCCAAATGGCT, and ending after CCCAAATGGTGGCCACAGAA at 17,230,393 bp (GRCm38/mm10). This mutation deletes exon 4 and 155 bp of flanking intronic sequence including the splice acceptor and donor, in addition there is a 17 bp deletion 53 bp before the 379 bp deletion and will not alter the effect of the 379 bp deletion. This mutation is predicted to cause a change of amino acid sequence after residue 127 and early truncation 14 amino acids later. |