|  Help  |  About  |  Contact Us

Allele : Efhc2<em1(IMPC)J> EF-hand domain (C-terminal) containing 2; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5810347 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Efhc2
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Efhc2-8032J-F7960 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGGAGGATCCCAAAAAGTAC, GGGAGGATCCCAAAAAGTAC, ATAAATTCCTGCTAGCCAAA and ATTTGGCTAGCAGGAATTTA, which resulted in a 379 bp deletion beginning at Chromosome X negative strand position 17,230,771 bp TTCCTGCTAGCCAAATGGCT, and ending after CCCAAATGGTGGCCACAGAA at 17,230,393 bp (GRCm38/mm10). This mutation deletes exon 4 and 155 bp of flanking intronic sequence including the splice acceptor and donor, in addition there is a 17 bp deletion 53 bp before the 379 bp deletion and will not alter the effect of the 379 bp deletion. This mutation is predicted to cause a change of amino acid sequence after residue 127 and early truncation 14 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Efhc2<em1J>,
  • Efhc2<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

3 Publication categories