Primary Identifier | MGI:6153273 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Akr1e1 |
Strain of Origin | C57BL/6N | Is Recombinase | false |
Is Wild Type | false | Project Collection | IMPC |
molecularNote | This allele from IMPC was generated at Welcome Trust Sanger Institute by injecting CAS9 RNA and 4 guide sequences CCTCCAACACTCAAATATCCGTT, CCGTTAGGATCCAGATTAGCACA, CCACAGTGTATCAACGTATTTCA, CCTCACCATCAATAGCTAGGTAC, which resulted in a Exon Deletion. |