Primary Identifier | MGI:5803696 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | AU040320 |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele from project AU040320-7997J-M0236 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GACTCACAGTAATCTCGTGC, TTCGATTCTGCCTCAGATGC, GACAACTGTTTTCGTTAGAG and TTGCTCATGCATAGATGCGG, which resulted in a 614 bp deletion beginning at Chromosome 4 positive strand position 126,791,731 bp, CTCGTGCTGGGTTCTTCCTA, and ending after TTAAATCTATTCCTCCGCAT at 126,792,344 bp (GRCm38/mm10). This mutation deletes exon 3 and 93 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 29 bp (TAGAGCGGAAGCTGCTCATTATCTGTTC) deletion 129 bp after the 614 bp deletion. This mutation is predicted to cause a change of amino acid sequence after residue 47 and early truncation 13 amino acids later. |