| Primary Identifier | MGI:5754575 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Gpr141b |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0383 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and three guide RNAs with the spacer sequences CACTTGAGCCATTTGACACG, GTTACAAAAGTTCCATGCCG and TTATACCCCACCATGCATTC. This resulted in a 737-bp deletion in Chr13:19729115 to 19729852 (ENSMUSE00000732266; GRCm38). This mutation is predicted to cause a frameshift with amino acid changes after residue 10 and early truncation 41 amino acids later (p.S10Ffs*43). |
