Primary Identifier | MGI:6314758 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Mtx2 |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TAAGTTTAGGAAAAGAATGA and CTTACTTGAGCTCTGGTCCG, which resulted in a 406 bp deletion beginning at Chromosome 2 position 74,859,326 bp and ending after 74,859,731 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001238985 (exon 4) and 333 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 45 and early truncation 11 amino acids later. |