Primary Identifier | MGI:6385154 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Pwwp2b |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TAGATGGAGACAGGCCAAAG and TTCTGGGGCCACGTGTTGTG, which resulted in a 1631 bp deletion beginning at Chromosome 7 position 139,254,777 bp and ending after 139,256,407 bp (GRCm38/mm10). This mutation deletes 1631 bp from ENSMUSE00000911429 (exon 2) and is predicted to cause a change of amino acid sequence after residue 44 and early truncation 10 amino acids later. |