Primary Identifier | MGI:6414771 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Cfap58 |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGAAAGACCCCCCAAACAAA and TCATGAGCCCATTTTGCCCA, which resulted in a 350 bp deletion beginning at Chromosome 19 position 47,948,074 bp and ending after 47,948,423 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000617882 (exon 4) and 193 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 147 and early truncation 66 amino acids later. |