|  Help  |  About  |  Contact Us

Allele : Rr249<em2Ebres> regulatory region 249; endonuclease-mediated mutation 2, Emery H Bresnick

Primary Identifier  MGI:7330390 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr249
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  The intronic Gata2 enhancer was targeted with an sgRNA (targeting TCTCCTGCCGGAGTTTCCTATCCGG) and an ssODN template (TTTCAAAACAGCCCAGCAAGAGGCAGGACTGAGTCGAGGTGGCTCTGAAAACTTGCCGGTCCAGAAACAGATACACGAAGTTTCCTTATCTACCGGCTGCAGATGTCCGGATAGGAAACTCCGGC) using CRISPR/Cas9 technology, resulting in a C-to-T mutation disabling the Ets motif TTCC by changing it to TTCT.
  • mutations:
  • Single point mutation
  • synonyms:
  • Gata2 +9.5(Ets)<->,
  • Gata2 +9.5(Ets)<->
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories

Trail: Allele