| Primary Identifier | MGI:6727371 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Atxn7l1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTTGTGATAACGATAAGCGG and TCTGGAGTGTAGCTGCAAGT, which resulted in a 478 bp deletion beginning at Chromosome 12 position 33,391,845 bp and ending after 33,392,322 bp (GRCm39/mm39). This mutation deletes ENSMUSE00000655323 (exon 3) and 203 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause an early truncation after amino acid 68. |
