|  Help  |  About  |  Contact Us

Allele : Lrif1<em1(IMPC)J> ligand dependent nuclear receptor interacting factor 1; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6342842 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Lrif1
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TACCAAGTAGTTCCTACGAT and AACAGTTGCTGCATCAACAG, which resulted in a 643 bp deletion beginning at Chromosome 3 position 106,732,447 bp and ending after 106,733,089 bp (GRCm38/mm10). This mutation deletes 643 bp of ENSMUSE00000413972 (exon 2) and is predicted to cause a change of amino acid sequence after residue 282 and early truncation 25 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele