Primary Identifier | MGI:7331568 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Smim17 |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGAACACTAGAAAGAGAGCA and ATAGACTGTGCATATCCACA, which resulted in a 7666 bp deletion beginning at Chromosome 7 position 6,427,547 bp and ending after 6,435,212 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001308241, ENSMUSE00001279438, ENSMUSE00000864604 (exons 2, 3, and 4) and 4539 bp of intronic sequence including the splice acceptor and donor the start site and 3â UTR and is predicted to result in a null allele. There is a 3 bp deletion (GTC) 5 bases after the 3â coordinate. |