| Primary Identifier | MGI:6406675 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Arap1 |
| Strain of Origin | C57BL/6N | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Intron 19 and exon 21 were targeted with sgRNAs (targeting TATGGGTCATGAATAAGGCCTGG and TGTACATCCAGGGTGAGCGGCGG) using CRISPR/Cas9 technology, resulting in a 222bp deletion encompassing exon 20 and a 5' part of exon 21. |
