| Primary Identifier | MGI:6260061 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Zbtb44 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGGCATCTAAAAAGCAGCCT and CCCCCATACAACAACCCTGA, which resulted in a 404 bp deletion beginning at Chromosome 9 position 31,063,974 bp and ending after 31,064,377 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000413910 (exon 4) and 388 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 368 and early truncation 1 amino acid later. In addition, there is a 23 bp insertion (ACTGTAGGAACTGATGAGAGTTG) at the deletion site. |
