| Primary Identifier | MGI:6316204 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Pebp1 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0388 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of TTTTAGTAGCGGCCATACTT and GAATTACCACTAATCTGCAT targeting the 5' side and GGCTATCTATCATCCGGACA and ATTCTGCCGTCCTTACAGTA targeting the 3' side of exons ENSMUSE00000292490 and ENSMUSE00000292484 resulting in a 809 bp deletion of Chr5 from 117285623 to 117286432 (GRCm38). This mutation is predicted to cause a frameshift with the amino acid changes after residue 47 and early truncation 11 amino acids later (p.M47Sfs*13). |
