|  Help  |  About  |  Contact Us

Allele : Tanc2<em1(IMPC)Hmgu> tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2; endonuclease-mediated mutation 1, Helmholtz Zentrum Muenchen GmbH

Primary Identifier  MGI:6384591 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Tanc2
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NCrl
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from IMPC was generated at Helmholtz-Zentrum Muenchen by injecting CAS9 Protein and 4 guide sequences AGGCTGTGCATGAAAGCTTCTGG, CCAAGTATATGTGGATTATTGCC, AAATGTAGATCCCTAGCGTGAGG, TACGCTATTCCAAGTATATGTGG, which resulted in a Exon Deletion.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Tanc2<-em1/CRISPR/Cas>,
  • Tanc2<-em1/CRISPR/Cas>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

5 Publication categories

Trail: Allele