|  Help  |  About  |  Contact Us

Allele : Tmem63c<em1(IMPC)Rbrc> transmembrane protein 63c; endonuclease-mediated mutation 1, RIKEN BioResource Center

Primary Identifier  MGI:6257549 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Tmem63c
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJcl
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from IMPC was generated at RIKEN BioResource Center by injecting CAS9 Protein and 2 guide sequences ATACACCATATTTGTCGAGAAGG, ATTGGCCAGTTGATCATTGAAGG, which resulted in a Exon Deletion.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele