Primary Identifier | MGI:6306944 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Ppig |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCTTCAGCAGTCAATAGGTA and GCTTCTGTACGTATGTGTCT, which resulted in a 582 bp deletion beginning at Chromosome 2 position 69,735,682 bp and ending after 69,736,263 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001290878 and ENSMUSE00001249525 (exons 8 and 9) and 412 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause early truncation after amino acid 126. |