|  Help  |  About  |  Contact Us

Allele : Ppig<em1(IMPC)J> peptidyl-prolyl isomerase G (cyclophilin G); endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6306944 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Ppig
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCTTCAGCAGTCAATAGGTA and GCTTCTGTACGTATGTGTCT, which resulted in a 582 bp deletion beginning at Chromosome 2 position 69,735,682 bp and ending after 69,736,263 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001290878 and ENSMUSE00001249525 (exons 8 and 9) and 412 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause early truncation after amino acid 126.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele