| Primary Identifier | MGI:6156569 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Zc3h12b |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0676 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and three guide RNAs with spacer sequences of AGCAAGTTGTATTCCCCTGC and CGCCCCGATGCACCAATTAC targeting the 5' side and CTCGGACCATGGCGTCCAAG targeting the 3' side of exons ENSMUSE00000842756 and ENSMUSE00001286785 resulting in a 2915-bp deletion of ChrX from 95922379 to 95925293. (GRCm38). |
