|  Help  |  About  |  Contact Us

Allele : Naa35<em1(IMPC)J> N(alpha)-acetyltransferase 35, NatC auxiliary subunit; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6314217 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Naa35
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CATAATTGAAAGCATCACTG and TAGGATACTTTTCACGAAGA, which resulted in a 306 bp deletion beginning at Chromosome 13 position 59,595,218 bp and ending after 59,595,523 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000118943 (exon 3) and 272 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 41 and early truncation 12 amino acids later. There is a 3 bp intronic deletion (TCT) 41 bp before the larger deletion site.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories