Primary Identifier | MGI:6208805 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Tmem131 |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences GTAAACATTTTTCTAAACAG, GTATGAGAGTAATGGTTACG, TATGAACTGTAGACAGTCAG and CTAATTACTCTACCTACCAT, which resulted in a 437 bp deletion beginning at Chromosome 1 position 36,889,104 bp and ending after 36,889,540 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000355789 (exon 2) and 375 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 60 and early truncation 1 amino acids later. |