| Primary Identifier | MGI:6879480 | Allele Type | Endonuclease-mediated |
| Attribute String | Not Specified | Gene | Rab39b |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | CRISPR/cas9 genome editing using guide RNAs upstream (GTATTTACTAAAGGACTGTC and CTAAAGGACTGTCAGGAATC) and downstream (ATGAGCCTTCTTCCTAGGCC and CCTGTCAGAGATCCAGGCCT) were selected to target exon 2. Donor DNAs were originally designed to insert a G192R mutation and a silent mutation N196N in exon 2. DNA sequencing of the targeted region identified founder 6951 with an 11 bp deletion (indel). This strain does not contain the point mutations. |
