| Primary Identifier | MGI:6231175 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Akap8l |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCTCTGCCTAGGAAAAACGG and TGGAGTCAAGAGACTCCAAA, which resulted in a 964 bp deletion beginning at Chromosome 17 position 32,335,377 bp and ending after 32,336,340 bp (GRCm38/mm10). This mutation deletes the last 56 bp of ENSMUSE00000137572 (exon 5), all of ENSMUSE00000137565, ENSMUSE00000137575, and ENSMUSE00000137582 (exons 6, 7, 8), and 679 bp of flanking intronic sequence including the splice acceptors and donors. This is predicted to cause a change of amino acid sequence after residue 254 and early truncation 11 amino acids later due to read through into the intron between exons 8 and 9. |
