| Primary Identifier | MGI:6307020 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | 4930558K02Rik |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CGCAGAAATGAAGGTTATGG and TCCGAAGACTAAATCTTAAA, which resulted in a 367 bp deletion beginning at Chromosome 1 position 161,967,700 bp and ending after 161,968,066 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001249072 (exon 2) and 281 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 7 and early truncation 20 amino acids later. |
